ID: 943071719_943071725

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 943071719 943071725
Species Human (GRCh38) Human (GRCh38)
Location 2:183148965-183148987 2:183148992-183149014
Sequence CCCCCCACCTTCTATAGATAATC TTGTTTCTTAAGAACATACTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!