ID: 943268077_943268080

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 943268077 943268080
Species Human (GRCh38) Human (GRCh38)
Location 2:185763128-185763150 2:185763161-185763183
Sequence CCTTGTCCCAGCAATATCAGCTT AAGTTATCTCTTCTTTCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234} {0: 1, 1: 0, 2: 5, 3: 46, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!