ID: 943299369_943299373

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 943299369 943299373
Species Human (GRCh38) Human (GRCh38)
Location 2:186178675-186178697 2:186178692-186178714
Sequence CCACCCTCAATCTGCAACTATAT CTATATGAAAAAATGGCAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!