ID: 943528093_943528095

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 943528093 943528095
Species Human (GRCh38) Human (GRCh38)
Location 2:189043239-189043261 2:189043254-189043276
Sequence CCACGAGGTCCTTGGGGTCCCTA GGTCCCTAGAAATAGAGATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 100} {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!