ID: 944091244_944091248

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 944091244 944091248
Species Human (GRCh38) Human (GRCh38)
Location 2:195914395-195914417 2:195914446-195914468
Sequence CCACTGGGTACAAGGTACAGCTG TATAGGTTCTTCAAGTGATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!