ID: 944165761_944165764

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 944165761 944165764
Species Human (GRCh38) Human (GRCh38)
Location 2:196718598-196718620 2:196718615-196718637
Sequence CCTCGAGGCTGTGGAGGACAGGG ACAGGGAAAACAAGAAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 273} {0: 1, 1: 0, 2: 3, 3: 78, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!