ID: 944509816_944509817

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 944509816 944509817
Species Human (GRCh38) Human (GRCh38)
Location 2:200453528-200453550 2:200453548-200453570
Sequence CCTTAAATGTATAAAGGAAGTTT TTTTCCTGCCTTGCAACTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 416} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!