ID: 944522103_944522110

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 944522103 944522110
Species Human (GRCh38) Human (GRCh38)
Location 2:200582274-200582296 2:200582320-200582342
Sequence CCTTATCCTGAAGATATTTGTCT ATTCACAACCCTATGGGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 271} {0: 1, 1: 0, 2: 0, 3: 14, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!