ID: 944648656_944648660

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 944648656 944648660
Species Human (GRCh38) Human (GRCh38)
Location 2:201806541-201806563 2:201806571-201806593
Sequence CCATCATGTGAGTCATATGAAAG CTGCTGACCTCTGGCAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 144} {0: 1, 1: 0, 2: 1, 3: 26, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!