ID: 944657592_944657597

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 944657592 944657597
Species Human (GRCh38) Human (GRCh38)
Location 2:201891517-201891539 2:201891547-201891569
Sequence CCTGGGTAAACCAGGATGGTTGG TGTGGCACAAATTACCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 54, 3: 139, 4: 349} {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!