ID: 944726684_944726690

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 944726684 944726690
Species Human (GRCh38) Human (GRCh38)
Location 2:202478486-202478508 2:202478505-202478527
Sequence CCCGTACTTCCAAAGTAGTCCCA CCCAACTGTTTGGAAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 2, 1: 59, 2: 1722, 3: 29832, 4: 247059}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!