ID: 944743626_944743644

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 944743626 944743644
Species Human (GRCh38) Human (GRCh38)
Location 2:202635216-202635238 2:202635244-202635266
Sequence CCCCCACGCCGGCCGGCTCCCTT TGGTGCGGTGGCCACGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185} {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!