ID: 944743627_944743643

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 944743627 944743643
Species Human (GRCh38) Human (GRCh38)
Location 2:202635217-202635239 2:202635243-202635265
Sequence CCCCACGCCGGCCGGCTCCCTTG GTGGTGCGGTGGCCACGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81} {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!