ID: 944760546_944760553

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 944760546 944760553
Species Human (GRCh38) Human (GRCh38)
Location 2:202809382-202809404 2:202809399-202809421
Sequence CCCCACGCCTGTAATCCCAGTAC CAGTACTTCGAGAGGCCAAGCGG
Strand - +
Off-target summary {0: 27, 1: 1090, 2: 2848, 3: 2710, 4: 2550} {0: 1, 1: 4, 2: 146, 3: 1736, 4: 3632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!