ID: 944796024_944796027

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 944796024 944796027
Species Human (GRCh38) Human (GRCh38)
Location 2:203186250-203186272 2:203186301-203186323
Sequence CCTAAAATTCAGTATCTCATTAT TACTCAGATGTGGCTCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 585} {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!