ID: 944816260_944816261

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 944816260 944816261
Species Human (GRCh38) Human (GRCh38)
Location 2:203379007-203379029 2:203379049-203379071
Sequence CCACTAAATTGCAGCTTGCAGTT GTACTAATTACCTGTGTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154} {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!