ID: 944909138_944909143

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 944909138 944909143
Species Human (GRCh38) Human (GRCh38)
Location 2:204292168-204292190 2:204292212-204292234
Sequence CCATAAATCTTACATAGGGACAA TCTTTTAAAAGGCAAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 19, 4: 181} {0: 1, 1: 0, 2: 14, 3: 146, 4: 1128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!