ID: 944937029_944937033

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 944937029 944937033
Species Human (GRCh38) Human (GRCh38)
Location 2:204580084-204580106 2:204580099-204580121
Sequence CCTTGACCCAGGGGGACCCATAG ACCCATAGTCTAGACTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 13, 4: 106} {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!