ID: 944965817_944965821

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 944965817 944965821
Species Human (GRCh38) Human (GRCh38)
Location 2:204931704-204931726 2:204931732-204931754
Sequence CCTGTTACTTACTGGCCCTGTAT TAATTCACATAAATCCTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124} {0: 1, 1: 0, 2: 1, 3: 30, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!