ID: 944991298_944991307

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 944991298 944991307
Species Human (GRCh38) Human (GRCh38)
Location 2:205239210-205239232 2:205239247-205239269
Sequence CCTTTTTATTTTCATGCTACTCC AAGGTGTTCTAGGTGCTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 413} {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!