ID: 945015170_945015177

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 945015170 945015177
Species Human (GRCh38) Human (GRCh38)
Location 2:205507584-205507606 2:205507630-205507652
Sequence CCAGACTCCATAAATAAGGATAG AAATCAAGGTGCTGTTAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131} {0: 1, 1: 0, 2: 5, 3: 33, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!