ID: 945077698_945077702

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 945077698 945077702
Species Human (GRCh38) Human (GRCh38)
Location 2:206056732-206056754 2:206056750-206056772
Sequence CCAGGTAGTGGAGAGGGACCCTT CCCTTGCCCCAGGTGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 27, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!