ID: 945234391_945234396

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 945234391 945234396
Species Human (GRCh38) Human (GRCh38)
Location 2:207621372-207621394 2:207621415-207621437
Sequence CCTCAGCAATGAAGAAAAGACTA GGGTTAAATCAGATAGTGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 287} {0: 1, 1: 0, 2: 3, 3: 20, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!