ID: 945275519_945275530

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 945275519 945275530
Species Human (GRCh38) Human (GRCh38)
Location 2:207983862-207983884 2:207983910-207983932
Sequence CCATCCTCATGGCCACCTTCATC CCACTTCACCCACTGTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 553} {0: 1, 1: 0, 2: 2, 3: 14, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!