ID: 945306833_945306845

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 945306833 945306845
Species Human (GRCh38) Human (GRCh38)
Location 2:208266607-208266629 2:208266629-208266651
Sequence CCCCGGCTGCCTTGTCTGGCGAG GTGGGGACGGAAGCCGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 1, 2: 4, 3: 26, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!