ID: 945320310_945320316

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 945320310 945320316
Species Human (GRCh38) Human (GRCh38)
Location 2:208414015-208414037 2:208414052-208414074
Sequence CCTATCTTAGTGCACCTAATGGG ACTAGGGCCCACTGTTTTACTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 57, 3: 67, 4: 75} {0: 1, 1: 18, 2: 74, 3: 75, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!