ID: 945326980_945326984

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 945326980 945326984
Species Human (GRCh38) Human (GRCh38)
Location 2:208493367-208493389 2:208493383-208493405
Sequence CCGTGACGCACAGCACCAGCAGC CAGCAGCCAGTCACAGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 234} {0: 1, 1: 0, 2: 4, 3: 34, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!