ID: 945404806_945404809

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 945404806 945404809
Species Human (GRCh38) Human (GRCh38)
Location 2:209432294-209432316 2:209432311-209432333
Sequence CCTTCCTGTTTCTCTGCCTACAG CTACAGTGCTCTATCCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 429} {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!