ID: 945458949_945458954

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 945458949 945458954
Species Human (GRCh38) Human (GRCh38)
Location 2:210082021-210082043 2:210082047-210082069
Sequence CCTTCTTGGCTCAAGTGATGCTC CCTCAGGCCTCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 674, 3: 10037, 4: 52113} {0: 4, 1: 194, 2: 7223, 3: 117656, 4: 220418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!