|
Left Crispr |
Right Crispr |
Crispr ID |
945458949 |
945458954 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:210082021-210082043
|
2:210082047-210082069
|
Sequence |
CCTTCTTGGCTCAAGTGATGCTC |
CCTCAGGCCTCTGAGTAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 11, 2: 674, 3: 10037, 4: 52113} |
{0: 4, 1: 194, 2: 7223, 3: 117656, 4: 220418} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|