ID: 945555845_945555850

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 945555845 945555850
Species Human (GRCh38) Human (GRCh38)
Location 2:211274844-211274866 2:211274872-211274894
Sequence CCAGAAAGGACAAAAATTAATCA GACCCTTATATGCCTTGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!