ID: 945576046_945576048

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 945576046 945576048
Species Human (GRCh38) Human (GRCh38)
Location 2:211530537-211530559 2:211530551-211530573
Sequence CCATAGCTAACCTAAGCAAAAAC AGCAAAAACAACAAAACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 338, 4: 1845} {0: 1, 1: 110, 2: 1232, 3: 7423, 4: 17296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!