ID: 945600266_945600269

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 945600266 945600269
Species Human (GRCh38) Human (GRCh38)
Location 2:211853890-211853912 2:211853910-211853932
Sequence CCAGATGCCACTGTGAGATTGGT GGTTATGTGTGTTCAGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102} {0: 1, 1: 0, 2: 2, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!