ID: 945642175_945642181

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 945642175 945642181
Species Human (GRCh38) Human (GRCh38)
Location 2:212443808-212443830 2:212443853-212443875
Sequence CCTGCCATGTTCTGCAGATAAGT CTTGGACTATTACTGGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 210, 3: 191, 4: 244} {0: 1, 1: 20, 2: 209, 3: 165, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!