ID: 945770402_945770414

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 945770402 945770414
Species Human (GRCh38) Human (GRCh38)
Location 2:214035295-214035317 2:214035338-214035360
Sequence CCAGGCTTCAGGCCCTCCCCAGC GGGACCTGCCCCTTATGCCCAGG
Strand - +
Off-target summary {0: 12, 1: 27, 2: 73, 3: 282, 4: 1002} {0: 1, 1: 1, 2: 3, 3: 24, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!