ID: 945811826_945811832

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 945811826 945811832
Species Human (GRCh38) Human (GRCh38)
Location 2:214558266-214558288 2:214558315-214558337
Sequence CCCTCTTTCTTCTTGCAGGACAT CAATTACCATTCATTTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 382} {0: 1, 1: 0, 2: 3, 3: 22, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!