ID: 945858498_945858507

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 945858498 945858507
Species Human (GRCh38) Human (GRCh38)
Location 2:215094432-215094454 2:215094471-215094493
Sequence CCACTGAAGTTGTCCACCTATCA GGCAAATGGTTCTTAGACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97} {0: 3, 1: 98, 2: 113, 3: 77, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!