ID: 946120515_946120524

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 946120515 946120524
Species Human (GRCh38) Human (GRCh38)
Location 2:217508982-217509004 2:217509035-217509057
Sequence CCCCAGAGAGCTAGCTAGTCCCT TTGTCTATGAATGAGGAGGTAGG
Strand - +
Off-target summary {0: 3, 1: 32, 2: 83, 3: 130, 4: 423} {0: 1, 1: 0, 2: 2, 3: 32, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!