ID: 946147068_946147073

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 946147068 946147073
Species Human (GRCh38) Human (GRCh38)
Location 2:217739053-217739075 2:217739077-217739099
Sequence CCATTGGCCACCAATAAATGGTT AGTATGCTGGGTAAGAGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124} {0: 1, 1: 0, 2: 3, 3: 31, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!