ID: 946155053_946155064

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 946155053 946155064
Species Human (GRCh38) Human (GRCh38)
Location 2:217801794-217801816 2:217801842-217801864
Sequence CCCTTCCCCATCATTCGCCTTGA CCTTCCGCAGGGATGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 149} {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!