ID: 946155964_946155980

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 946155964 946155980
Species Human (GRCh38) Human (GRCh38)
Location 2:217806834-217806856 2:217806875-217806897
Sequence CCACCTCCCCATGTGTCAGACAT CTTGCAGGCTGGTGGCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 180} {0: 1, 1: 0, 2: 2, 3: 28, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!