ID: 946158187_946158194

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 946158187 946158194
Species Human (GRCh38) Human (GRCh38)
Location 2:217820584-217820606 2:217820608-217820630
Sequence CCCAGGCTAGGGAGGGCAGTGGG ACGGCGAAGAAGGGATGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 98, 4: 837} {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!