ID: 946179530_946179541

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 946179530 946179541
Species Human (GRCh38) Human (GRCh38)
Location 2:217941339-217941361 2:217941372-217941394
Sequence CCTCAACTCCACACTGTCACGCA GGCAAGGGGCAGAGTGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181} {0: 1, 1: 0, 2: 7, 3: 81, 4: 649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!