ID: 946185492_946185499

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 946185492 946185499
Species Human (GRCh38) Human (GRCh38)
Location 2:217978550-217978572 2:217978563-217978585
Sequence CCGATTCCCCAGCCCGCCCCTGC CCGCCCCTGCCCCCGCCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 634} {0: 1, 1: 13, 2: 52, 3: 311, 4: 1897}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!