ID: 946189914_946189923

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 946189914 946189923
Species Human (GRCh38) Human (GRCh38)
Location 2:218002738-218002760 2:218002755-218002777
Sequence CCCCGACCCCGGGCTCTCAGCAA CAGCAAAAGGATAAGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 766} {0: 1, 1: 0, 2: 3, 3: 23, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!