ID: 946202818_946202822

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 946202818 946202822
Species Human (GRCh38) Human (GRCh38)
Location 2:218080791-218080813 2:218080807-218080829
Sequence CCAGTGCCAGGAATCACTGGTGA CTGGTGATCAGGGCCTTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 145} {0: 1, 1: 0, 2: 3, 3: 5, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!