ID: 946302348_946302361

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 946302348 946302361
Species Human (GRCh38) Human (GRCh38)
Location 2:218831708-218831730 2:218831752-218831774
Sequence CCGGCTCCGGCTCCCCTGGGACC GCTCCAGCCCGGGCTCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 404} {0: 1, 1: 0, 2: 0, 3: 33, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!