ID: 946313023_946313029

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 946313023 946313029
Species Human (GRCh38) Human (GRCh38)
Location 2:218893284-218893306 2:218893299-218893321
Sequence CCCCTGGGCCCTGATCGAGGTCC CGAGGTCCCCTCCTGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109} {0: 1, 1: 0, 2: 3, 3: 24, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!