ID: 946320872_946320879

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 946320872 946320879
Species Human (GRCh38) Human (GRCh38)
Location 2:218953746-218953768 2:218953774-218953796
Sequence CCTGCTTGGCCCGCTGCATGGCG CAGCTCAGACAGCTTGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 12, 3: 17, 4: 105} {0: 1, 1: 7, 2: 15, 3: 33, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!