ID: 946364119_946364125

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 946364119 946364125
Species Human (GRCh38) Human (GRCh38)
Location 2:219237947-219237969 2:219237996-219238018
Sequence CCCTGGAACACCTGTGGATAGGA CTAGCTCTTAGCCACTGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156} {0: 1, 1: 0, 2: 2, 3: 14, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!