ID: 946405095_946405104

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 946405095 946405104
Species Human (GRCh38) Human (GRCh38)
Location 2:219488289-219488311 2:219488332-219488354
Sequence CCGCACATCTCCTGGATGAAAGG CAGAGAGGGAGGCCAGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171} {0: 1, 1: 1, 2: 5, 3: 62, 4: 709}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!